Detail of EST/Unigene AJ502290 |
Acc. | AJ502290 |
Internal Acc. | AJ502290 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Geranylgeranyl pyrophosphate synthase, chloroplastic OS=Hevea brasiliensis E-value=9e-57; Geranylgeranyl pyrophosphate synthase, chloroplastic OS=Catharanthus roseus E-value=1e-56; Heterodimeric geranylgeranyl pyrophosphate synthase large subunit 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-56; Geranylgeranyl pyrophosphate synthase, chloroplastic OS=Capsicum annuum E-value=1e-55; Geranylgeranyl pyrophosphate synthase 7, chloroplastic OS=Arabidopsis thaliana E-value=1e-55; |
Length | 657 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP (1 ESTs); |
Sequence | GGAACCACACAAATATCAATCACCAATAATGAGTTCCATGAATCTTGGTCCCAATTCTAT |
EST members of Unigene | AJ502290 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.5.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.31291.1.S1_at
|
Corresponding NCBI Gene | 829834 |
Trichome-related Gene from Literature | N/A |