| Detail of EST/Unigene AJ503783 |
| Acc. | AJ503783 |
| Internal Acc. | AJ503783 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71D11 (Fragment) OS=Lotus japonicus E-value=5e-22; Cytochrome P450 71D9 OS=Glycine max E-value=5e-21; Cytochrome P450 71D7 OS=Solanum chacoense E-value=2e-18; Cytochrome P450 71D6 OS=Solanum chacoense E-value=3e-18; Premnaspirodiene oxygenase OS=Hyoscyamus muticus E-value=1e-16; |
| Length | 299 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTAMP (1 ESTs); |
| Sequence | GGAAACTAAAAACATTCCCCTATTTCCTTTTTATCTACACATGGATCTTCAAACAATTTT |
| EST members of Unigene | AJ503783 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.4444.1.S1_at
|
| Corresponding NCBI Gene | 827771 |
| Trichome-related Gene from Literature | N/A |