Detail of EST/Unigene AJ547900 |
Acc. | AJ547900 |
Internal Acc. | AJ547900 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=1e-23; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=3e-23; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=4e-23; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=3e-22; Beta-glucosidase 40 OS=Arabidopsis thaliana E-value=1e-20; |
Length | 292 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAPHEU (1 ESTs); |
Sequence | GAAATGTGGCCATTGGATATTATTTCTCATTGCATCAATTTTATGTTCATAACTTTATCT |
EST members of Unigene | AJ547900 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.7629.1.S1_at
|
Corresponding NCBI Gene | 839196 |
Trichome-related Gene from Literature | N/A |