Detail of EST/Unigene AJ845645 |
Acc. | AJ845645 |
Internal Acc. | AJ845645 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-48; Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=5e-47; Thiamine thiazole synthase 2, chloroplastic OS=Vitis vinifera E-value=7e-47; Thiamine thiazole synthase 1, chloroplastic OS=Vitis vinifera E-value=7e-46; Thiamine thiazole synthase 2, chloroplastic OS=Sorghum bicolor E-value=1e-45; |
Length | 509 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtSNF (1 ESTs); |
Sequence | TCCAAACACCTAAAAACTAAATCCCCTTAATTGTAAACTTAACCATCAACAGGGCCCTGG |
EST members of Unigene | AJ845645 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.36057.1.S1_at
|
Corresponding NCBI Gene | 835567 |
Trichome-related Gene from Literature | N/A |