| Detail of EST/Unigene AL369611 |
| Acc. | AL369611 |
| Internal Acc. | MtBA32C01R1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase, chloroplastic OS=Arabidopsis thaliana E-value=8e-43; Argininosuccinate synthase OS=Desulfotomaculum reducens (strain MI-1) E-value=2e-28; Argininosuccinate synthase OS=Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI) E-value=2e-27; Argininosuccinate synthase OS=Moorella thermoacetica (strain ATCC 39073) E-value=6e-27; Argininosuccinate synthase (Fragment) OS=Heliobacillus mobilis E-value=8e-27; |
| Length | 465 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA (1 ESTs); |
| Sequence | AGATACATTAGCCCTTAAATATGCAGAGTTAGTGTATGCTGGTAGATGGTTTGATCCACT |
| EST members of Unigene | AL369611 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
| EC | 6.3.4.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.8838.1.S1_at
|
| Corresponding NCBI Gene | 828586 |
| Trichome-related Gene from Literature | N/A |