Detail of EST/Unigene AL370014 |
Acc. | AL370014 |
Internal Acc. | MtBA34H07R1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-24; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=9e-15; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=2e-14; Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=5e-14; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=6e-14; |
Length | 514 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (1 ESTs); |
Sequence | TTGGATTATGCTTGTGGGCAGGGGATTGATTGTAGCTTAATCCAACCAGGAGGTGCTTGT |
EST members of Unigene | AL370014 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.31555.1.S1_at
|
Corresponding NCBI Gene | 829599 |
Trichome-related Gene from Literature | N/A |