| Detail of EST/Unigene AL370070 |
| Acc. | AL370070 |
| Internal Acc. | MtBA35D03R1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP sulfurylase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-37; ATP-sulfurylase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-36; ATP sulfurylase 4, chloroplastic OS=Arabidopsis thaliana E-value=5e-32; ATP sulfurylase 2 OS=Arabidopsis thaliana E-value=1e-24; Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase OS=Urechis caupo E-value=8e-19; |
| Length | 508 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA (1 ESTs); |
| Sequence | CGCTTAAACATTCTTCCTTTCAGGGTTGCTGCATATGACAAGACTCAGGGTAAAATGGCA |
| EST members of Unigene | AL370070 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00860 adenylylsulfate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00860 adenylylsulfate kinase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00860 adenylylsulfate kinase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00958 sulfate adenylyltransferase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00958 sulfate adenylyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00958 sulfate adenylyltransferase |
| EC | 2.7.1.25 2.7.7.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.8428.1.S1_at
|
| Corresponding NCBI Gene | 821861 |
| Trichome-related Gene from Literature | N/A |