| Detail of EST/Unigene AL381495 |
| Acc. | AL381495 |
| Internal Acc. | MtBC01D01R2 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Rattus norvegicus E-value=4e-16; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Homo sapiens E-value=4e-16; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Mus musculus E-value=5e-16; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Bos taurus E-value=5e-16; Ubiquinone biosynthesis protein COQ9-B, mitochondrial OS=Xenopus laevis E-value=1e-15; |
| Length | 523 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
| Sequence | CGAAATTAGTCGATGACATGTGGTATCTCGCAGGCGACAAAAGTGCTGATATGAATTGGT |
| EST members of Unigene | AL381495 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.31812.1.S1_at
|
| Corresponding NCBI Gene | 838497 |
| Trichome-related Gene from Literature | N/A |