Detail of EST/Unigene AL381495 |
Acc. | AL381495 |
Internal Acc. | MtBC01D01R2 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Rattus norvegicus E-value=4e-16; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Homo sapiens E-value=4e-16; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Mus musculus E-value=5e-16; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Bos taurus E-value=5e-16; Ubiquinone biosynthesis protein COQ9-B, mitochondrial OS=Xenopus laevis E-value=1e-15; |
Length | 523 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
Sequence | CGAAATTAGTCGATGACATGTGGTATCTCGCAGGCGACAAAAGTGCTGATATGAATTGGT |
EST members of Unigene | AL381495 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.31812.1.S1_at
|
Corresponding NCBI Gene | 838497 |
Trichome-related Gene from Literature | N/A |