| Detail of EST/Unigene AL382022 |
| Acc. | AL382022 |
| Internal Acc. | MtBC04D05R1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic OS=Triticum aestivum E-value=5e-11; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=1e-10; Peroxiredoxin Q, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=2e-10; Peroxiredoxin Q, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-10; |
| Length | 392 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
| Sequence | TTCCGATGCTGGCGCTACCGTAGTTGGGTATCTCTTCGGATCCTGTTGACAAACATAAAA |
| EST members of Unigene | AL382022 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.31823.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |