| Detail of EST/Unigene AL385088 |
| Acc. | AL385088 |
| Internal Acc. | MtBC26C06F1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase, peroxisomal OS=Dictyostelium discoideum E-value=8e-45; Citrate synthase 2, peroxisomal OS=Arabidopsis thaliana E-value=9e-41; Citrate synthase, glyoxysomal OS=Cucurbita maxima E-value=4e-40; Citrate synthase 3, peroxisomal OS=Arabidopsis thaliana E-value=8e-40; Citrate synthase OS=Dictyostelium discoideum E-value=8e-37; |
| Length | 463 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
| Sequence | CAAAGATTATTAGAAATATTGCTTACGAGGTGTTTGATGTTTGTGGACGTGAACCACTTA |
| EST members of Unigene | AL385088 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.31904.1.S1_at
|
| Corresponding NCBI Gene | 825044 |
| Trichome-related Gene from Literature | N/A |