Detail of EST/Unigene AL385088 |
Acc. | AL385088 |
Internal Acc. | MtBC26C06F1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase, peroxisomal OS=Dictyostelium discoideum E-value=8e-45; Citrate synthase 2, peroxisomal OS=Arabidopsis thaliana E-value=9e-41; Citrate synthase, glyoxysomal OS=Cucurbita maxima E-value=4e-40; Citrate synthase 3, peroxisomal OS=Arabidopsis thaliana E-value=8e-40; Citrate synthase OS=Dictyostelium discoideum E-value=8e-37; |
Length | 463 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
Sequence | CAAAGATTATTAGAAATATTGCTTACGAGGTGTTTGATGTTTGTGGACGTGAACCACTTA |
EST members of Unigene | AL385088 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.31904.1.S1_at
|
Corresponding NCBI Gene | 825044 |
Trichome-related Gene from Literature | N/A |