| Detail of EST/Unigene AL385712 |
| Acc. | AL385712 |
| Internal Acc. | MtBC30B08F1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=1e-21; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=2e-21; Isoflavonoid 7-O-beta-apiosyl-glucoside beta-glycosidase OS=Dalbergia nigrescens E-value=2e-21; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=5e-21; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=1e-20; |
| Length | 223 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
| Sequence | CTGCAGTTGAACAAAATGGAAGACCTCTAGGTCCAAGGGCTGCTTCATTTTGGATATATG |
| EST members of Unigene | AL385712 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.4832.1.S1_at, Mtr.4832.1.S1_x_at
|
| Corresponding NCBI Gene | 825183 |
| Trichome-related Gene from Literature | N/A |