Detail of EST/Unigene AL385713 |
Acc. | AL385713 |
Internal Acc. | MtBC30B08R1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=8e-29; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=4e-27; Isoflavonoid 7-O-beta-apiosyl-glucoside beta-glycosidase OS=Dalbergia nigrescens E-value=3e-26; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=6e-26; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=1e-25; |
Length | 550 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
Sequence | TTGGTTCTAACCCACTTAACCTTGGGACAAATGGGGGTTANTGGAAATGGAATTTTCAAC |
EST members of Unigene | AL385713 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.31923.1.S1_at
|
Corresponding NCBI Gene | 834493 |
Trichome-related Gene from Literature | N/A |