| Detail of EST/Unigene AL387742 |
| Acc. | AL387742 |
| Internal Acc. | MtBC44D12F1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-66; Argininosuccinate synthase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=5e-62; Argininosuccinate synthase OS=Xenopus tropicalis E-value=5e-57; Argininosuccinate synthase OS=Homo sapiens E-value=1e-55; Argininosuccinate synthase OS=Bos taurus E-value=1e-55; |
| Length | 477 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
| Sequence | GAAGCTGCTAGAGAAAAAGCCTTGAAAATTGGCGCAAAAAAAGTTTATATTGAGGACTTA |
| EST members of Unigene | AL387742 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
| EC | 6.3.4.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.31980.1.S1_at
|
| Corresponding NCBI Gene | 828586 |
| Trichome-related Gene from Literature | N/A |