Detail of EST/Unigene AL387743 |
Acc. | AL387743 |
Internal Acc. | MtBC44D12R1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-36; Argininosuccinate synthase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-30; Argininosuccinate synthase OS=Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NS-E) E-value=6e-25; Argininosuccinate synthase OS=Thermotoga sp. (strain RQ2) E-value=2e-24; Argininosuccinate synthase OS=Thermotoga petrophila (strain RKU-1 / ATCC BAA-488 / DSM 13995) E-value=2e-24; |
Length | 523 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
Sequence | TAGCTCATATTGATTTAGAAGGTTTGGTCCTTGATCGTCAAGTTCGAGCATTGAGAGATC |
EST members of Unigene | AL387743 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
EC | 6.3.4.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.31981.1.S1_at
|
Corresponding NCBI Gene | 828586 |
Trichome-related Gene from Literature | N/A |