Detail of EST/Unigene AL389507 |
Acc. | AL389507 |
Internal Acc. | MtBC55C08R1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-carotene 3-hydroxylase, chloroplastic OS=Gentiana lutea E-value=1e-59; Beta-carotene hydroxylase 2, chloroplastic (Fragment) OS=Capsicum annuum E-value=3e-58; Beta-carotene hydroxylase 1, chloroplastic OS=Capsicum annuum E-value=4e-57; Beta-carotene 3-hydroxylase 2, chloroplastic OS=Arabidopsis thaliana 2 E-value=8e-55; Beta-carotene 3-hydroxylase 1, chloroplastic OS=Arabidopsis thaliana 1 E-value=8e-55; |
Length | 559 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
Sequence | GCTCTTTGGCATGCTTCCTTGTGGCACATGCATGAGTCCCATCATAGAGCAAGAGAAGGA |
EST members of Unigene | AL389507 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.39786.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |