Detail of EST/Unigene AL389511 |
Acc. | AL389511 |
Internal Acc. | MtBC55D01F1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase OS=Amanita muscaria E-value=6e-61; Glutamine synthetase OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) E-value=8e-60; Glutamine synthetase OS=Cryptococcus neoformans var. neoformans serotype D (strain B-3501A) E-value=8e-60; Glutamine synthetase OS=Suillus bovinus E-value=4e-59; Glutamine synthetase OS=Tuber borchii E-value=7e-59; |
Length | 445 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
Sequence | AGTCAAACACTGAAACTCTTGCAAAATACCTTTCTCTCGACCAAGGTGGTAAAGTTCAAG |
EST members of Unigene | AL389511 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.4925.1.S1_at
|
Corresponding NCBI Gene | 821050 |
Trichome-related Gene from Literature | N/A |