| Detail of EST/Unigene AL389602 |
| Acc. | AL389602 |
| Internal Acc. | MtBC56A04F1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetyl-coenzyme A synthetase OS=Coprinopsis cinerea E-value=1e-61; Acetyl-coenzyme A synthetase OS=Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003) E-value=4e-61; Acetyl-coenzyme A synthetase OS=Phycomyces blakesleeanus E-value=9e-61; Acetyl-coenzyme A synthetase OS=Dictyostelium discoideum E-value=1e-58; Acetyl-coenzyme A synthetase OS=Drosophila melanogaster E-value=2e-57; |
| Length | 430 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
| Sequence | TCCACTGTTTTTACTTTATACTTCAGGATCTACAGGAAAACCTAAAGGTGTTGTTCATAC |
| EST members of Unigene | AL389602 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
| EC | 6.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.32027.1.S1_at
|
| Corresponding NCBI Gene | 833655 |
| Trichome-related Gene from Literature | N/A |