Detail of EST/Unigene AL389865 |
Acc. | AL389865 |
Internal Acc. | MtBC57H10R1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 93A2 OS=Glycine max E-value=6e-28; Cytochrome P450 93A1 OS=Glycine max E-value=5e-27; Cytochrome P450 93A3 OS=Glycine max E-value=2e-26; Cytochrome P450 705A5 OS=Arabidopsis thaliana E-value=3e-25; Beta-amyrin 24-hydroxylase OS=Glycine max E-value=1e-24; |
Length | 526 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); |
Sequence | TTGCAAAATCAACGGCTATGATATCAAAGCTCATACAAGGACACTTGTCAATGTCTATGC |
EST members of Unigene | AL389865 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07424 cytochrome P450, family 3, subfamily A |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.13746.1.S1_at
|
Corresponding NCBI Gene | 818826 |
Trichome-related Gene from Literature | N/A |