| Detail of EST/Unigene AM832009 |
| Acc. | AM832009 |
| Internal Acc. | AM832009 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin, muscle-type A2 OS=Bombyx mori E-value=3e-47; Actin, clone 211 OS=Artemia sp. E-value=3e-47; Actin, clone 205 OS=Artemia sp. E-value=3e-47; Actin, indirect flight muscle OS=Drosophila simulans E-value=9e-47; Actin, indirect flight muscle OS=Drosophila melanogaster E-value=9e-47; |
| Length | 466 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_SL (1 ESTs); |
| Sequence | GAAACGATTAACGCGCTAATAAATACATTTTTTTATTTCAAAAATCGAACTGTTATTTTA |
| EST members of Unigene | AM832009 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830841 |
| Trichome-related Gene from Literature | 830841 |