Detail of EST/Unigene AW126011 |
Acc. | AW126011 |
Internal Acc. | N100207e |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Formaldehyde dismutase OS=Pseudomonas putida E-value=3e-25; Glutathione-independent formaldehyde dehydrogenase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=3e-25; Glutathione-independent formaldehyde dehydrogenase OS=Pseudomonas putida E-value=8e-25; Uncharacterized zinc-type alcohol dehydrogenase-like protein YycR OS=Bacillus subtilis (strain 168) E-value=5e-21; Uncharacterized zinc-type alcohol dehydrogenase-like protein YbdR OS=Escherichia coli (strain K12) E-value=5e-16; |
Length | 429 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS (1 ESTs); |
Sequence | GGTATTACCAGCAAAGATAAAGAAGAAAAAACTGATATGCCACGAACCATGAAAGGATGT |
EST members of Unigene | AW126011 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.-.-.- 1.1.1.14 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32036.1.S1_at
|
Corresponding NCBI Gene | 840172 |
Trichome-related Gene from Literature | N/A |