Detail of EST/Unigene AW560207 |
Acc. | AW560207 |
Internal Acc. | EST315263 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=3e-44; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=8e-44; Beta-fructofuranosidase, insoluble isoenzyme CWINV5 OS=Arabidopsis thaliana E-value=9e-40; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=4e-37; Beta-fructofuranosidase, insoluble isoenzyme CWINV4 OS=Arabidopsis thaliana E-value=8e-36; |
Length | 534 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR (1 ESTs); |
Sequence | TACTAAGATGTCATGATTACTACTTCATTGGGAAATATGTATCTTATTCTGATCAGGAAA |
EST members of Unigene | AW560207 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37485.1.S1_at
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |