| Detail of EST/Unigene AW560207 |
| Acc. | AW560207 |
| Internal Acc. | EST315263 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=3e-44; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=8e-44; Beta-fructofuranosidase, insoluble isoenzyme CWINV5 OS=Arabidopsis thaliana E-value=9e-40; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=4e-37; Beta-fructofuranosidase, insoluble isoenzyme CWINV4 OS=Arabidopsis thaliana E-value=8e-36; |
| Length | 534 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR (1 ESTs); |
| Sequence | TACTAAGATGTCATGATTACTACTTCATTGGGAAATATGTATCTTATTCTGATCAGGAAA |
| EST members of Unigene | AW560207 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.37485.1.S1_at
|
| Corresponding NCBI Gene | 820591 |
| Trichome-related Gene from Literature | N/A |