| Detail of EST/Unigene AW775671 |
| Acc. | AW775671 |
| Internal Acc. | EST334736 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | CRS2-associated factor 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-75; CRS2-associated factor 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-66; CRS2-associated factor 2, chloroplastic OS=Zea mays E-value=2e-65; CRS2-associated factor 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-49; CRS2-associated factor 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-47; |
| Length | 624 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (1 ESTs); |
| Sequence | TTATCTTTTCCGCGGCAGAAATTACAACTACCGTACTCGTCCACAGTATCCAGTGATGCT |
| EST members of Unigene | AW775671 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.1744.1.S1_at
|
| Corresponding NCBI Gene | 838948 |
| Trichome-related Gene from Literature | N/A |