| Detail of EST/Unigene AW776463 |
| Acc. | AW776463 |
| Internal Acc. | EST335528 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase 2, chloroplastic OS=Vitis vinifera E-value=1e-50; Thiamine thiazole synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-49; Thiamine thiazole synthase 1, chloroplastic OS=Vitis vinifera E-value=7e-49; Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=9e-49; Thiamine thiazole synthase, chloroplastic OS=Alnus glutinosa E-value=1e-47; |
| Length | 644 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (1 ESTs); |
| Sequence | CCTCTTCTCTTCCCAAAATACCCCTAATGGCATCCATGGCCACTGCATCTCTCGCCACTT |
| EST members of Unigene | AW776463 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2574.1.S1_at
|
| Corresponding NCBI Gene | 835567 |
| Trichome-related Gene from Literature | N/A |