Detail of EST/Unigene AW776463 |
Acc. | AW776463 |
Internal Acc. | EST335528 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase 2, chloroplastic OS=Vitis vinifera E-value=1e-50; Thiamine thiazole synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-49; Thiamine thiazole synthase 1, chloroplastic OS=Vitis vinifera E-value=7e-49; Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=9e-49; Thiamine thiazole synthase, chloroplastic OS=Alnus glutinosa E-value=1e-47; |
Length | 644 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); |
Sequence | CCTCTTCTCTTCCCAAAATACCCCTAATGGCATCCATGGCCACTGCATCTCTCGCCACTT |
EST members of Unigene | AW776463 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2574.1.S1_at
|
Corresponding NCBI Gene | 835567 |
Trichome-related Gene from Literature | N/A |