Detail of EST/Unigene AW776630 |
Acc. | AW776630 |
Internal Acc. | EST335695 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-22; 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=7e-08; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=5e-07; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=5e-07; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=8e-07; |
Length | 719 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); |
Sequence | TCGGCCCGAGGTTTGAATATAGCATAATAACCAACCATGGCTGGTGCAAGCACTGGTTCC |
EST members of Unigene | AW776630 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.27411.1.S1_s_at
|
Corresponding NCBI Gene | 824403 |
Trichome-related Gene from Literature | N/A |