Detail of EST/Unigene BE124062 |
Acc. | BE124062 |
Internal Acc. | EST394187 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-49; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=1e-48; Glutathione S-transferase U22 OS=Arabidopsis thaliana E-value=6e-48; Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=3e-47; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=5e-47; |
Length | 429 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); |
Sequence | CTGATGAAGTGATTCTTCTAGATTACTGGGTAAGTCCATTTGACCTGAGGGTCATAATAG |
EST members of Unigene | BE124062 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1237.1.S1_s_at
|
Corresponding NCBI Gene | 844169 |
Trichome-related Gene from Literature | N/A |