| Detail of EST/Unigene BE124062 |
| Acc. | BE124062 |
| Internal Acc. | EST394187 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-49; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=1e-48; Glutathione S-transferase U22 OS=Arabidopsis thaliana E-value=6e-48; Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=3e-47; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=5e-47; |
| Length | 429 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (1 ESTs); |
| Sequence | CTGATGAAGTGATTCTTCTAGATTACTGGGTAAGTCCATTTGACCTGAGGGTCATAATAG |
| EST members of Unigene | BE124062 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1237.1.S1_s_at
|
| Corresponding NCBI Gene | 844169 |
| Trichome-related Gene from Literature | N/A |