Detail of EST/Unigene BE124239 |
Acc. | BE124239 |
Internal Acc. | EST394364 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=2e-51; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-35; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=8e-35; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-34; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=5e-34; |
Length | 428 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); |
Sequence | GTAATGGCAACCACACCTGCTTTGTATGGAACTGCAGTGAGCACTTTCTTCCTTAGGAGG |
EST members of Unigene | BE124239 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.25043.1.S1_at
|
Corresponding NCBI Gene | 837639 |
Trichome-related Gene from Literature | N/A |