| Detail of EST/Unigene BE124239 |
| Acc. | BE124239 |
| Internal Acc. | EST394364 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=2e-51; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-35; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=8e-35; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-34; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=5e-34; |
| Length | 428 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (1 ESTs); |
| Sequence | GTAATGGCAACCACACCTGCTTTGTATGGAACTGCAGTGAGCACTTTCTTCCTTAGGAGG |
| EST members of Unigene | BE124239 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.25043.1.S1_at
|
| Corresponding NCBI Gene | 837639 |
| Trichome-related Gene from Literature | N/A |