Detail of EST/Unigene BE124836 |
Acc. | BE124836 |
Internal Acc. | EST393871 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase nodule isozyme OS=Medicago sativa E-value=1e-33; Glutamine synthetase cytosolic isozyme 1-2 OS=Arabidopsis thaliana E-value=1e-32; Glutamine synthetase root isozyme 4 OS=Zea mays E-value=2e-32; Glutamine synthetase root isozyme A OS=Pisum sativum E-value=2e-32; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=3e-32; |
Length | 496 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN (1 ESTs); |
Sequence | CTATAGCTATTAGTGTATTACTTGCTTTTCACACACTGAGTACTTCTTCTTCCTTCACTA |
EST members of Unigene | BE124836 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.1798.1.S1_s_at
|
Corresponding NCBI Gene | 842935 |
Trichome-related Gene from Literature | N/A |