Detail of EST/Unigene BE202602 |
Acc. | BE202602 |
Internal Acc. | EST402624 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Dynein intermediate chain 3, ciliary OS=Anthocidaris crassispina E-value=6e-20; Dynein, 70 kDa intermediate chain, flagellar outer arm OS=Chlamydomonas reinhardtii E-value=2e-17; Dynein intermediate chain 2, axonemal OS=Rattus norvegicus E-value=3e-17; Dynein intermediate chain 2, axonemal OS=Mus musculus E-value=1e-16; Dynein intermediate chain 2, axonemal OS=Homo sapiens E-value=6e-16; |
Length | 581 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1 (1 ESTs); |
Sequence | GATCACGTGGATCATTCTTCTGAACCACCCTCCGCAAAGGGTCTCGCGGTGTTCCGTGAC |
EST members of Unigene | BE202602 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.27481.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |