| Detail of EST/Unigene BE202777 |
| Acc. | BE202777 |
| Internal Acc. | EST402809 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | GDP-mannose 3,5-epimerase OS=Arabidopsis thaliana E-value=2e-53; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. japonica E-value=7e-53; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. indica E-value=4e-52; GDP-mannose 3,5-epimerase 2 OS=Oryza sativa subsp. japonica E-value=1e-49; |
| Length | 538 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV1 (1 ESTs); |
| Sequence | GATAGCATACCATTTTCCACCAATTGCCTCTCTCAACTCATACCTTTTCTCTCCGTTCAT |
| EST members of Unigene | BE202777 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.32170.1.S1_s_at
|
| Corresponding NCBI Gene | 833002 |
| Trichome-related Gene from Literature | N/A |