Detail of EST/Unigene BE202777 |
Acc. | BE202777 |
Internal Acc. | EST402809 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | GDP-mannose 3,5-epimerase OS=Arabidopsis thaliana E-value=2e-53; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. japonica E-value=7e-53; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. indica E-value=4e-52; GDP-mannose 3,5-epimerase 2 OS=Oryza sativa subsp. japonica E-value=1e-49; |
Length | 538 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1 (1 ESTs); |
Sequence | GATAGCATACCATTTTCCACCAATTGCCTCTCTCAACTCATACCTTTTCTCTCCGTTCAT |
EST members of Unigene | BE202777 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32170.1.S1_s_at
|
Corresponding NCBI Gene | 833002 |
Trichome-related Gene from Literature | N/A |