Detail of EST/Unigene BE202932 |
Acc. | BE202932 |
Internal Acc. | EST402954 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Secologanin synthase OS=Catharanthus roseus E-value=3e-64; Cytochrome P450 72C1 OS=Arabidopsis thaliana E-value=2e-62; Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=3e-47; Cytochrome P450 734A6 OS=Oryza sativa subsp. japonica E-value=2e-45; Cytochrome P450 734A5 OS=Oryza sativa subsp. japonica E-value=4e-45; |
Length | 638 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1 (1 ESTs); |
Sequence | CATGCATCTTAAGTTTTTTGAATAAGCAACATTACAGGCATCTTAAGTTTTTTTTGAATA |
EST members of Unigene | BE202932 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07425 cytochrome P450, family 4, subfamily A |
EC | 1.14.14.1 1.14.15.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.3549.1.S1_at
|
Corresponding NCBI Gene | 820696 |
Trichome-related Gene from Literature | N/A |