Detail of EST/Unigene BE203325 |
Acc. | BE203325 |
Internal Acc. | EST403347 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplastic/chromoplastic (Fragment) OS=Solanum lycopersicum E-value=3e-25; 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplastic OS=Arabidopsis thaliana E-value=7e-23; 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplastic OS=Mentha piperita E-value=2e-22; 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-18; |
Length | 575 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1 (1 ESTs); |
Sequence | AAAGCTTTACTTTCATAGACCTCAGTTTGTCAAAGTCAAAGCCATGGTTTCTGACTCTTC |
EST members of Unigene | BE203325 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.27504.1.S1_at
|
Corresponding NCBI Gene | 817234 |
Trichome-related Gene from Literature | N/A |