| Detail of EST/Unigene BE203325 |
| Acc. | BE203325 |
| Internal Acc. | EST403347 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplastic/chromoplastic (Fragment) OS=Solanum lycopersicum E-value=3e-25; 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplastic OS=Arabidopsis thaliana E-value=7e-23; 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplastic OS=Mentha piperita E-value=2e-22; 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-18; |
| Length | 575 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV1 (1 ESTs); |
| Sequence | AAAGCTTTACTTTCATAGACCTCAGTTTGTCAAAGTCAAAGCCATGGTTTCTGACTCTTC |
| EST members of Unigene | BE203325 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.27504.1.S1_at
|
| Corresponding NCBI Gene | 817234 |
| Trichome-related Gene from Literature | N/A |