Detail of EST/Unigene BE204779 |
Acc. | BE204779 |
Internal Acc. | EST397455 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=6e-27; Zeaxanthin epoxidase, chloroplastic OS=Solanum lycopersicum E-value=5e-26; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-25; Zeaxanthin epoxidase, chloroplastic OS=Capsicum annuum E-value=6e-25; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=8e-25; |
Length | 517 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0 (1 ESTs); |
Sequence | TTGTTTTCTTAACATTAACAACAGACTCCAACAATGGTTTCTACTTTGTCTCACAAATGT |
EST members of Unigene | BE204779 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.1857.1.S1_at
|
Corresponding NCBI Gene | 836838 |
Trichome-related Gene from Literature | N/A |