| Detail of EST/Unigene BE204779 |
| Acc. | BE204779 |
| Internal Acc. | EST397455 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=6e-27; Zeaxanthin epoxidase, chloroplastic OS=Solanum lycopersicum E-value=5e-26; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-25; Zeaxanthin epoxidase, chloroplastic OS=Capsicum annuum E-value=6e-25; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=8e-25; |
| Length | 517 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV0 (1 ESTs); |
| Sequence | TTGTTTTCTTAACATTAACAACAGACTCCAACAATGGTTTCTACTTTGTCTCACAAATGT |
| EST members of Unigene | BE204779 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.1857.1.S1_at
|
| Corresponding NCBI Gene | 836838 |
| Trichome-related Gene from Literature | N/A |