| Detail of EST/Unigene BE997394 |
| Acc. | BE997394 |
| Internal Acc. | EST429117 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-carotene 3-hydroxylase, chloroplastic OS=Gentiana lutea E-value=4e-12; Beta-carotene 3-hydroxylase 1, chloroplastic OS=Arabidopsis thaliana 1 E-value=4e-12; Beta-carotene hydroxylase 2, chloroplastic (Fragment) OS=Capsicum annuum E-value=8e-12; Beta-carotene 3-hydroxylase 2, chloroplastic OS=Arabidopsis thaliana 2 E-value=1e-10; Beta-carotene hydroxylase 1, chloroplastic OS=Capsicum annuum E-value=5e-09; |
| Length | 181 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVSN (1 ESTs); |
| Sequence | TCTGAATCCATAAATACCTTATTCAAATATGAATTGGAATTGTTGCAGTCACATCATCGA |
| EST members of Unigene | BE997394 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.27721.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |