Detail of EST/Unigene BF519614 |
Acc. | BF519614 |
Internal Acc. | EST457078 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit XI, chloroplastic OS=Arabidopsis thaliana E-value=3e-70; Photosystem I reaction center subunit XI, chloroplastic OS=Cucumis sativus E-value=2e-69; Photosystem I reaction center subunit XI, chloroplastic OS=Spinacia oleracea E-value=4e-67; Photosystem I reaction center subunit XI, chloroplastic OS=Hordeum vulgare E-value=2e-58; Photosystem I reaction center subunit XI OS=Guillardia theta E-value=1e-18; |
Length | 662 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); |
Sequence | TTAAGTCATGGCAGCTGCTTCTCCTATGGCAAGCCAACTCAAGTCCAGCTTCACTAGACC |
EST members of Unigene | BF519614 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.49751.1.S1_at
|
Corresponding NCBI Gene | 826892 |
Trichome-related Gene from Literature | N/A |