| Detail of EST/Unigene BF519986 |
| Acc. | BF519986 |
| Internal Acc. | EST457454 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase 1-1 OS=Drosophila simulans E-value=1e-40; Glutathione S-transferase 1-1 OS=Drosophila melanogaster E-value=1e-40; Glutathione S-transferase 1-1 OS=Drosophila sechellia E-value=2e-40; Glutathione S-transferase 1-1 OS=Drosophila yakuba E-value=3e-40; Glutathione S-transferase 1 OS=Musca domestica E-value=4e-40; |
| Length | 532 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (1 ESTs); |
| Sequence | GCTCAAGTGTACTCGAATTCCATACACATCTTAAAAATGTCATCCATAGATTTTTACTAT |
| EST members of Unigene | BF519986 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.2094.1.S1_at
|
| Corresponding NCBI Gene | 817636 |
| Trichome-related Gene from Literature | N/A |