Detail of EST/Unigene BF520260 |
Acc. | BF520260 |
Internal Acc. | EST457730 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=1e-69; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=2e-43; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=1e-41; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=2e-41; Carbonic anhydrase OS=Flaveria brownii E-value=5e-39; |
Length | 619 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); |
Sequence | GAACACATCATCATATAGCTATATAGCATTGTGATTTGAGTCTTCATTGTCACAATGTCT |
EST members of Unigene | BF520260 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42982.1.S1_s_at
|
Corresponding NCBI Gene | 821134 |
Trichome-related Gene from Literature | N/A |