| Detail of EST/Unigene BF520260 |
| Acc. | BF520260 |
| Internal Acc. | EST457730 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=1e-69; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=2e-43; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=1e-41; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=2e-41; Carbonic anhydrase OS=Flaveria brownii E-value=5e-39; |
| Length | 619 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (1 ESTs); |
| Sequence | GAACACATCATCATATAGCTATATAGCATTGTGATTTGAGTCTTCATTGTCACAATGTCT |
| EST members of Unigene | BF520260 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42982.1.S1_s_at
|
| Corresponding NCBI Gene | 821134 |
| Trichome-related Gene from Literature | N/A |