Detail of EST/Unigene BF521246 |
Acc. | BF521246 |
Internal Acc. | EST458657 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=7e-23; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=2e-20; Ribulose bisphosphate carboxylase small chain 1B, chloroplastic OS=Arabidopsis thaliana E-value=2e-19; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Glycine max E-value=2e-19; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Raphanus sativus E-value=3e-19; |
Length | 206 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); |
Sequence | ATCTCCTCCGCCGCTGTCACCACCGCTTACCGCGTCTACGCTAACTTGGTTGCTCCATTC |
EST members of Unigene | BF521246 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.19516.1.S1_at
|
Corresponding NCBI Gene | 833830 |
Trichome-related Gene from Literature | N/A |