| Detail of EST/Unigene BF521287 |
| Acc. | BF521287 |
| Internal Acc. | EST458698 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin, muscle OS=Manduca sexta E-value=2e-41; Actin, cytoplasmic OS=Branchiostoma floridae E-value=2e-41; Actin, cytoplasmic OS=Branchiostoma belcheri E-value=2e-41; Actin, acrosomal process isoform OS=Limulus polyphemus E-value=2e-41; Actin-6 (Fragment) OS=Diphyllobothrium dendriticum E-value=2e-41; |
| Length | 251 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (1 ESTs); |
| Sequence | TGCTCTCCTTGTACGCTTCCGGTCGTACCACCGGTATCGTTTTGGATTCTGGTGATGGTG |
| EST members of Unigene | BF521287 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.3664.1.S1_at
|
| Corresponding NCBI Gene | 824542 |
| Trichome-related Gene from Literature | N/A |