Detail of EST/Unigene BF521287 |
Acc. | BF521287 |
Internal Acc. | EST458698 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Actin, muscle OS=Manduca sexta E-value=2e-41; Actin, cytoplasmic OS=Branchiostoma floridae E-value=2e-41; Actin, cytoplasmic OS=Branchiostoma belcheri E-value=2e-41; Actin, acrosomal process isoform OS=Limulus polyphemus E-value=2e-41; Actin-6 (Fragment) OS=Diphyllobothrium dendriticum E-value=2e-41; |
Length | 251 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); |
Sequence | TGCTCTCCTTGTACGCTTCCGGTCGTACCACCGGTATCGTTTTGGATTCTGGTGATGGTG |
EST members of Unigene | BF521287 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.3664.1.S1_at
|
Corresponding NCBI Gene | 824542 |
Trichome-related Gene from Literature | N/A |