| Detail of EST/Unigene BG588505 |
| Acc. | BG588505 |
| Internal Acc. | EST490324 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A thioesterase 9, mitochondrial OS=Mus musculus E-value=2e-20; Acyl-coenzyme A thioesterase 10, mitochondrial OS=Mus musculus E-value=6e-20; Acyl-coenzyme A thioesterase 9, mitochondrial OS=Homo sapiens E-value=8e-19; Acyl-coenzyme A thioesterase 9, mitochondrial OS=Bos taurus E-value=1e-17; |
| Length | 782 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MHRP-root (1 ESTs); |
| Sequence | GGAAACTTAAAGACCTATTGGCCGAGGGTAGAATTTTCTGTGACATGCCAGCCTTAGCCG |
| EST members of Unigene | BG588505 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.1.2.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.28309.1.S1_at
|
| Corresponding NCBI Gene | 834890 |
| Trichome-related Gene from Literature | N/A |