Detail of EST/Unigene BG646437 |
Acc. | BG646437 |
Internal Acc. | EST508056 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Capsanthin/capsorubin synthase, chromoplast OS=Citrus sinensis E-value=2e-63; Neoxanthin synthase, chloroplastic OS=Solanum tuberosum E-value=2e-57; Capsanthin/capsorubin synthase, chromoplast OS=Capsicum annuum E-value=2e-55; Lycopene beta cyclase, chloroplastic OS=Arabidopsis thaliana E-value=3e-49; Lycopene beta cyclase, chloroplastic OS=Solanum lycopersicum E-value=8e-47; |
Length | 601 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA (1 ESTs); |
Sequence | GGCCTTGTCTCACACCGGAGGTGAAAACGAAGAATGGTTGCAAGGTTAAAGCATTTGGGA |
EST members of Unigene | BG646437 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.2484.1.S1_at
|
Corresponding NCBI Gene | 820185 |
Trichome-related Gene from Literature | N/A |