| Detail of EST/Unigene BG646437 |
| Acc. | BG646437 |
| Internal Acc. | EST508056 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Capsanthin/capsorubin synthase, chromoplast OS=Citrus sinensis E-value=2e-63; Neoxanthin synthase, chloroplastic OS=Solanum tuberosum E-value=2e-57; Capsanthin/capsorubin synthase, chromoplast OS=Capsicum annuum E-value=2e-55; Lycopene beta cyclase, chloroplastic OS=Arabidopsis thaliana E-value=3e-49; Lycopene beta cyclase, chloroplastic OS=Solanum lycopersicum E-value=8e-47; |
| Length | 601 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (1 ESTs); |
| Sequence | GGCCTTGTCTCACACCGGAGGTGAAAACGAAGAATGGTTGCAAGGTTAAAGCATTTGGGA |
| EST members of Unigene | BG646437 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.2484.1.S1_at
|
| Corresponding NCBI Gene | 820185 |
| Trichome-related Gene from Literature | N/A |