Detail of EST/Unigene BG646924 |
Acc. | BG646924 |
Internal Acc. | EST508543 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Small heat shock protein, chloroplastic OS=Petunia hybrida E-value=5e-19; Small heat shock protein, chloroplastic (Fragment) OS=Glycine max E-value=1e-17; Small heat shock protein, chloroplastic OS=Pisum sativum E-value=4e-17; Small heat shock protein, chloroplastic OS=Solanum lycopersicum E-value=6e-17; 25.3 kDa heat shock protein, chloroplastic OS=Arabidopsis thaliana E-value=2e-16; |
Length | 703 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA (1 ESTs); |
Sequence | AAGCCAAGCTTGCAAAGGGCAAAGCAGCATCAGTTGCCACCAAAGATGAAGGTGTCACAA |
EST members of Unigene | BG646924 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.2494.1.S1_s_at
|
Corresponding NCBI Gene | 828881 |
Trichome-related Gene from Literature | N/A |