| Detail of EST/Unigene BG647774 |
| Acc. | BG647774 |
| Internal Acc. | EST509393 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione peroxidase 5 OS=Arabidopsis thaliana E-value=3e-50; Probable glutathione peroxidase 4 OS=Arabidopsis thaliana E-value=2e-48; Probable phospholipid hydroperoxide glutathione peroxidase OS=Solanum lycopersicum E-value=2e-47; Probable phospholipid hydroperoxide glutathione peroxidase OS=Spinacia oleracea E-value=1e-46; Probable phospholipid hydroperoxide glutathione peroxidase OS=Helianthus annuus E-value=2e-46; |
| Length | 756 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (1 ESTs); |
| Sequence | TGTTGAAACAAAGTGTGAACGACCCAAATCAATCTTAGCATACACATAGTCTTACTCCTA |
| EST members of Unigene | BG647774 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
| EC | 1.11.1.12 1.11.1.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.44501.1.S1_at
|
| Corresponding NCBI Gene | 825483 |
| Trichome-related Gene from Literature | N/A |