Detail of EST/Unigene BG647774 |
Acc. | BG647774 |
Internal Acc. | EST509393 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione peroxidase 5 OS=Arabidopsis thaliana E-value=3e-50; Probable glutathione peroxidase 4 OS=Arabidopsis thaliana E-value=2e-48; Probable phospholipid hydroperoxide glutathione peroxidase OS=Solanum lycopersicum E-value=2e-47; Probable phospholipid hydroperoxide glutathione peroxidase OS=Spinacia oleracea E-value=1e-46; Probable phospholipid hydroperoxide glutathione peroxidase OS=Helianthus annuus E-value=2e-46; |
Length | 756 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA (1 ESTs); |
Sequence | TGTTGAAACAAAGTGTGAACGACCCAAATCAATCTTAGCATACACATAGTCTTACTCCTA |
EST members of Unigene | BG647774 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.12 1.11.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.44501.1.S1_at
|
Corresponding NCBI Gene | 825483 |
Trichome-related Gene from Literature | N/A |