| Detail of EST/Unigene BG647881 |
| Acc. | BG647881 |
| Internal Acc. | EST509500 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase 2 OS=Dictyostelium discoideum E-value=9e-32; Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=2e-30; Serine hydroxymethyltransferase, mitochondrial OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) E-value=4e-29; Serine hydroxymethyltransferase OS=Caenorhabditis briggsae E-value=5e-29; Serine hydroxymethyltransferase, mitochondrial OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) E-value=2e-28; |
| Length | 793 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (1 ESTs); |
| Sequence | GGGGATCGAATTATGGGGTTGGATACTCCTTCTGGAGGGAATACTAGTCATGGATATTAT |
| EST members of Unigene | BG647881 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.28528.1.S1_at
|
| Corresponding NCBI Gene | 838807 |
| Trichome-related Gene from Literature | N/A |