| Detail of EST/Unigene BI309140 |
| Acc. | BI309140 |
| Internal Acc. | EST530550 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=6e-46; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=3e-43; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=1e-35; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=9e-34; Probable carotenoid cleavage dioxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=5e-14; |
| Length | 589 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD (1 ESTs); |
| Sequence | GACCTGATTTCGGCAAAACAAAGCTTGAAATTGGAGGAAATGTTCATGGTATCTATGACT |
| EST members of Unigene | BI309140 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.14.99.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.30480.1.S1_at
|
| Corresponding NCBI Gene | 825527 |
| Trichome-related Gene from Literature | N/A |