Detail of EST/Unigene BM778905 |
Acc. | BM778905 |
Internal Acc. | EST589480 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin CPN60-2, mitochondrial OS=Cucurbita maxima E-value=4e-14; Chaperonin CPN60, mitochondrial OS=Arabidopsis thaliana E-value=1e-13; Chaperonin CPN60-1, mitochondrial OS=Cucurbita maxima E-value=2e-13; Chaperonin CPN60-like 1, mitochondrial OS=Arabidopsis thaliana E-value=3e-13; Chaperonin CPN60-1, mitochondrial OS=Zea mays E-value=4e-13; |
Length | 456 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2 (1 ESTs); |
Sequence | TGCTTTGACGGGGAAGACAATTGTTAAAGACCATTGCTTCAGTCGACCCTGAGTTATTTC |
EST members of Unigene | BM778905 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.3868.1.S1_at
|
Corresponding NCBI Gene | 821983 |
Trichome-related Gene from Literature | N/A |