| Detail of EST/Unigene BM780250 |
| Acc. | BM780250 |
| Internal Acc. | EST590826 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase OS=Eimeria tenella E-value=2e-23; Pyruvate kinase OS=Geobacillus stearothermophilus E-value=9e-19; Pyruvate kinase OS=Bacillus psychrophilus E-value=1e-17; Pyruvate kinase OS=Staphylococcus epidermidis (strain ATCC 12228) E-value=2e-17; Pyruvate kinase OS=Staphylococcus epidermidis (strain ATCC 35984 / RP62A) E-value=2e-17; |
| Length | 621 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2 (1 ESTs); |
| Sequence | GGCACGAAGGACTCGAAAGAAAAAAAGAGTCTCTTTTTTCGTCGTATCTTCTGCTTCTGC |
| EST members of Unigene | BM780250 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
| EC | 2.7.1.40 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.28771.1.S1_at
|
| Corresponding NCBI Gene | 819560 |
| Trichome-related Gene from Literature | N/A |