Detail of EST/Unigene BM780250 |
Acc. | BM780250 |
Internal Acc. | EST590826 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase OS=Eimeria tenella E-value=2e-23; Pyruvate kinase OS=Geobacillus stearothermophilus E-value=9e-19; Pyruvate kinase OS=Bacillus psychrophilus E-value=1e-17; Pyruvate kinase OS=Staphylococcus epidermidis (strain ATCC 12228) E-value=2e-17; Pyruvate kinase OS=Staphylococcus epidermidis (strain ATCC 35984 / RP62A) E-value=2e-17; |
Length | 621 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2 (1 ESTs); |
Sequence | GGCACGAAGGACTCGAAAGAAAAAAAGAGTCTCTTTTTTCGTCGTATCTTCTGCTTCTGC |
EST members of Unigene | BM780250 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.28771.1.S1_at
|
Corresponding NCBI Gene | 819560 |
Trichome-related Gene from Literature | N/A |