Detail of EST/Unigene BQ145176 |
Acc. | BQ145176 |
Internal Acc. | NF011C11GS1F1085 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=3e-12; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=3e-12; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=9e-12; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=1e-11; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Glycine tabacina E-value=3e-11; |
Length | 641 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (1 ESTs); |
Sequence | GANAATGAAAAAGGTACCATTTCATTTATTAACTCTTATCCATACATTTGCATTTTGAAA |
EST members of Unigene | BQ145176 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |