Detail of EST/Unigene BQ145407 |
Acc. | BQ145407 |
Internal Acc. | NF006G03GS1F1023 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase N-1 OS=Phaseolus vulgaris E-value=3e-30; Glutamine synthetase PR-2 OS=Phaseolus vulgaris E-value=4e-30; Glutamine synthetase cytosolic isozyme OS=Medicago sativa E-value=6e-30; Glutamine synthetase cytosolic isozyme OS=Pinus sylvestris E-value=7e-30; Glutamine synthetase cytosolic isozyme 1 OS=Glycine max E-value=1e-29; |
Length | 841 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (1 ESTs); |
Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ145407 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10422.1.S1_at
|
Corresponding NCBI Gene | 821050 |
Trichome-related Gene from Literature | N/A |