| Detail of EST/Unigene BQ152161 |
| Acc. | BQ152161 |
| Internal Acc. | NF011D04IR1F1041 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Malate synthase, glyoxysomal OS=Cucumis sativus E-value=3e-49; Malate synthase, glyoxysomal (Fragment) OS=Glycine max E-value=7e-49; Malate synthase, glyoxysomal OS=Cucurbita maxima E-value=7e-49; Malate synthase, glyoxysomal OS=Brassica napus E-value=1e-44; Malate synthase, glyoxysomal OS=Gossypium hirsutum E-value=3e-44; |
| Length | 777 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (1 ESTs); |
| Sequence | TGATNCGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
| EST members of Unigene | BQ152161 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.38932.1.S1_at
|
| Corresponding NCBI Gene | 831690 |
| Trichome-related Gene from Literature | N/A |