Detail of EST/Unigene BQ152161 |
Acc. | BQ152161 |
Internal Acc. | NF011D04IR1F1041 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Malate synthase, glyoxysomal OS=Cucumis sativus E-value=3e-49; Malate synthase, glyoxysomal (Fragment) OS=Glycine max E-value=7e-49; Malate synthase, glyoxysomal OS=Cucurbita maxima E-value=7e-49; Malate synthase, glyoxysomal OS=Brassica napus E-value=1e-44; Malate synthase, glyoxysomal OS=Gossypium hirsutum E-value=3e-44; |
Length | 777 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (1 ESTs); |
Sequence | TGATNCGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | BQ152161 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.38932.1.S1_at
|
Corresponding NCBI Gene | 831690 |
Trichome-related Gene from Literature | N/A |