Detail of EST/Unigene BQ152184 |
Acc. | BQ152184 |
Internal Acc. | NF013A04IR1F1024 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=1e-33; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=7e-33; |
Length | 679 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (1 ESTs); |
Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ152184 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37209.1.S1_s_at
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |