| Detail of EST/Unigene BQ152184 |
| Acc. | BQ152184 |
| Internal Acc. | NF013A04IR1F1024 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=1e-33; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=7e-33; |
| Length | 679 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (1 ESTs); |
| Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | BQ152184 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.37209.1.S1_s_at
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |